Lunapark deficiency leads to an autosomal recessive neurodevelopmental phenotype with a degenerative course, epilepsy and distinct brain anomalies.

LNPK encodes a conserved membrane protein that stabilizes the junctions of the tubular endoplasmic reticulum network playing crucial roles in diverse biological functions. Recently, homozygous variants in LNPK were shown to cause a neurodevelopmental disorder (OMIM#618090) in four patients displaying developmental delay, epilepsy and nonspecific brain malformations including corpus callosum hypoplasia and variable impairment of cerebellum. We sought to delineate the molecular and phenotypic spectrum of LNPK-related disorder. Exome or genome sequencing was carried out in 11 families. Thorough clinical and neuroradiological evaluation was performed for all the affected individuals, including review of previously reported patients. We identified 12 distinct homozygous loss-of-function variants in 16 individuals presenting with moderate to profound developmental delay, cognitive impairment, regression, refractory epilepsy and a recognizable neuroimaging pattern consisting of corpus callosum hypoplasia and signal alterations of the forceps minor ('ear-of-the-lynx' sign), variably associated with substantia nigra signal alterations, mild brain atrophy, short midbrain and cerebellar hypoplasia/atrophy. In summary, we define the core phenotype of LNPK-related disorder and expand the list of neurological disorders presenting with the 'ear-of-the-lynx' sign suggesting a possible common underlying mechanism related to endoplasmic reticulum-phagy dysfunction.

Quality of life among caregivers of epileptic children with degree of controlling seizures in Aseer region.

Epilepsy affects nearly 50 million people worldwide. Epilepsy can affect the quality of life of both the child and the caregiver leaving them unable to function in other areas of life. This quality of life is highly dependent on treatment adherence and how individuals feel about taking their medication. In our study, we aimed to investigate the frequency of medication adherence and the quality of life of caregivers of children with epilepsy. For this purpose, we conducted a cross-sectional survey at the Abha Maternity and Children's Hospital. We enrolled 133 consecutive participants and asked them to complete a questionnaire. The results showed that 37.6% of the participants forgot to take their medications, 9.8% of the participants reported that they were sometimes careless about giving their children medications and sometimes stopped giving them when the children were feeling better, 15.8% of the participants indicated that they sometimes stopped giving the medication when they felt that their children were getting worse when they took the medication., and 26.3% of the participants agreed that they only administered the medication when the children were sick. It was also found that the quality of life of the caregivers decreased when they forgot to give their children the medication and the quality of life of the caregivers increased when they continued to take the medication. In conclusion, quality of life increases as adherence to treatment increases, indicating that more intervention programs are needed to improve the adherence of epilepsy patients.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

Vanishing white matter in Saudi Arabia.

Vanishing white matter disease (VWMD) is an under-diagnosed condition that affects the brains white matter at all ages, especially in the pediatric age group. It belongs to a clinically and genetically heterogeneous group of disorders, collectively known as eukaryotic initiation factor 2B-related disorders. The disorder has been described in different ethnic groups. Here, we describe a case of VWMD from Saudi Arabia.